The Existence of God

by Robert Herman BS, AM, MD

Scientists have postulated that life on this planet began in a “primordal soup”, a pond or sheltered bay that was teaming with thousands of chemicals.  Over millions or billions of years, as these chemicals interacted, life was eventually formed.  Let us take a critical and realistic look at how this could have been accomplished, going from non-life to life.

The type of life forms we have on this planet are composed of cells.  So the simplest life form is a single celled organism, such as a bacterium.  It seems likely that if life began as a bacterium and then evolved into more complex forms there would had to have been the synthesis of a bacterium “from scratch” in the primordal soup by numerous random chemical reactions.  Is such a thing probable?  Let us imagine the steps involved.

We can begin with the DNA.  DNA is a molecule composed of nucleotides.  A nucleotide is made of three parts:  a sugar molecule, a fairly strong acid and a weak base.  The interesting parts are the bases.  There are four of them:  adenine, guanine, thymine and cytosine, or A, G, T and C for short.  These bases are the “letters” in the genetic code.

DNA is shaped like a ladder with the sugars and acids as the sides of the ladder and the bases as the rungs.  The other side of the ladder has a base which pairs so that we have a “base pair”.  If A is on one side then T is always on the other.  C always pairs with G.  So if the genetic code on one side is TTAGTCCAG, then the code on the other side is AATCAGGTC, for example.  Thus when discussing DNA we talk about the number of “base pairs”.

Human DNA has about three billion base pairs.  A simple bacterium such as E. Coli has 600,000 base pairs.  Let us say that this first bacterium had 500,000 base pairs so one million bases, or nucleotides.  So if we start with creating this primordal bacterium from scratch, the first thing we need to do is synthsize one million nucleotides from random chemical reactions.  I suppose over millions of years a million nucleotides could form.  But consider this.  As stated, a nucleotide has a base on one side and an acid on the other.  This makes it a very reactive molecule.  Since we are postulating that there were thousands of chemicals in this promordal soup, how long could it take before a nucleotide reacts with another chemical?  I would conjecture that a nucleotide might last, at most, about one second before it bonds with something.  So the question is not “could one million nucleotides possibly be synthesized by random chemical interactions” but rather “could one million nucleotides be synthesized within one second of each other by random interactions”?  What are the odds of this happening?  I would say about one chance in some number that would stretch across our entire galaxy.

The next thing to consider is the placement of these nucleotides in the soup.  For instance if some of the nucleotides are 10 meters away from the others then they would be too far apart to react with each other in this one second time period.  So all the synthesis needs to occur in close proximity.  How close?  I would imagine at least within one cubic centimeter of each other.  So what are the odds of one million nucleotides being synthesized within one cubic centimeter of each other?  I would say one chance in some number that would travel across a second galaxy.

The next thing to consider is that these two events have to occur simultaneously.  The nucleotides need to be synthsized within one second and within one cubic centimeter of each other.  To calculate the odds of this occurring we would need to take the number from the first galaxy and multiply it by the number from the second galaxy.

The next step is to form a DNA chain 500,000 base pairs long.  However, if two nucleotides approached each other might we expect the acid group from one to react with the base from the other.  Why would they even form a chain at all?  But for the sake of argument let us say that they do start to form a chain, perhaps four nucleotides long.  Since there are postulated to be thousands of chemicals in this soup then what would prevent a different chemical from bonding to this chain.  It could be an alcohol, a ketone, an ester or one of a host of other molecules.  Then we would no  longer have DNA but another chemical.  So what are the odds that we can actually get a DNA chain 500,000 base pairs long?  I think we are up to a third galaxy of numbers.

We then need to consider the genetic code.  We cannot have just any old DNA chain but we would have to get the code right.  Remember there are four bases with 500,000 base pairs.  Think of the number of possible combination of bases going from one end of the DNA to the other.  The code could be:  ATTTCAGCAGTATAACC… etc.  Or could it be:  CCCATCATCATGGAAGGCAGCAG…, etc, etc, etc.  This is complicated by the number of bases involved.  If we are speculating on one million nucleotides with four bases, were there 250,000 of each base?  Not likely.  Perhaps there were 249,999 A and Ts and 250,001 C and Gs, or 249,998 A and Ts and 250,002 C and Gs, or 189,537 A and Ts with a corresponding number of C and Gs.  Not only could there be numeous combinations of numbers of bases but then think of all the possible combination of bases for each possible combination of number.  Then consider the likelihood of the code coming about by chance.  What are the odds of this happening?

After all this, as improbable as it could be, if we did get this far what would we have?  A strand of naked DNA floating in this primordal soup. One of the issues regarding DNA is that it is a fragile molecule.  It could be destroyed by heat, changes in pH, mechanical shearing forces and of course by the thousands of chemicals in the soup.  So how long could DNA remain in this soup before it is destroyed?  Probably at most one second.  So the DNA would have one second to build a cell wall around itself to protect it from its environment.  What are all the stages in this process and how could it just happen to occur?  Perhaps the cell wall was built first.  But then we would stil have all the multitude of other issues involved in creating DNA.

We do not know all the processes involved in building one cell.  There are probably billions of steps involved, each one needing to be done in the correct order with the precise temperature, pH, salinity, concentration of calcium, magnesium, phosphorous, carbon, etc, etc, etc.

Astronomers tell us that our universe is so large that we should just about consider it to be infinite.  However, I do not think that our universe is large enough to come up with a number massive enough to calculate the odds of a single cell being created by a series of random events.

In his book “The God Delusion” Richard Dawkins stated that the odds of a cell being created by random events is about one in a billion.  Since there are possibly one billion planets in our galaxy capable of supporting life then the odds that a bacterium could have been created somewhere is a possibility.  If it occurred on another planet then it could have been transported to our earth on a meteor or something. (1)

One chance in a billion!!!  To create an entire cell!!!  Richard Dawkins has a PhD in biology.  This is inexcusable.  If he had thought about this for more than two seconds he would have quickly realized that the odds of just getting a proper genetic code are so infinitessamly small that no one in their right mind could consider this happening by random events.  If Professor Dawkins was a Medical Doctor he should be sued for scientific malpractice.

Life is complex.  Even one cell is so complex we can only vaguely understand it.  How can something so complex be created by a series of random events.  This is a preposterous supposition.  We obviously needed an intelligent Creator to create such intelligent life.

(1) The God Delusion by Richard Dawkins. Bantam Press 2006. pp 165-166.

Robert Herman, BS, AM, MD received a BS in Chemistry from Lake Erie College, a Master’s in Chemistry from Dartmouth College (after doing DNA research) and an MD from the University of Cincinnati. His paper, Existence of God, Part One – Science, is reprinted with his permission.